Nameaae-bantam-5p
AccessionMIMAT0014218
SpeciesAedes aegypti
Precursorsaae-bantam
Descriptionexperimental
ExperimentSolexa (Skalsky RL 2010)
Sequence
CCGGUUUUCAUUUUCGAUCUGAC

Seed family [0]

Seed family - other species [3]

Papers [8]