Nameaae-miR-1
AccessionMIMAT0014244
SpeciesAedes aegypti
Precursorsaae-mir-1
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
UGGAAUGUAAAGAAGUAUGGAG

Seed family [0]

Seed family - other species [111]

Papers [8]