Nameaae-miR-100
AccessionMIMAT0014291
SpeciesAedes aegypti
Precursorsaae-mir-100
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
AACCCGUAGAUCCGAACUUGUG

Seed family [0]

Seed family - other species [128]

Papers [8]