Nameaae-miR-1000
AccessionMIMAT0014297
SpeciesAedes aegypti
Precursorsaae-mir-1000-1, aae-mir-1000-2
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
AUAUUGUCCUGUCACAGCAGU

Seed family [1]

Seed family - other species [12]

Papers [8]