Nameaae-miR-11-3p
AccessionMIMAT0014242
SpeciesAedes aegypti
Precursorsaae-mir-11
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
CAUCACAGUCUGAGUUCUUGCU

Seed family - other species [194]

Papers [8]