Nameaae-miR-1174
AccessionMIMAT0014265
SpeciesAedes aegypti
Precursorsaae-mir-1174
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
UCAGAUCUACUUAAUACCCAU

Seed family [0]

Seed family - other species [10]

Papers [8]