Nameaae-miR-12-3p
AccessionMIMAT0014254
SpeciesAedes aegypti
Precursorsaae-mir-12
Descriptionexperimental
ExperimentSolexa (Skalsky RL 2010)
Sequence
CAGUACUUAUGUUAUGCUCUCU

Seed family [1]

Seed family - other species [2]

Papers [8]