Nameaae-miR-12-5p
AccessionMIMAT0014253
SpeciesAedes aegypti
Precursorsaae-mir-12
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
UGAGUAUUACAUCAGGUACUGGU

Seed family [0]

Seed family - other species [46]

Papers [8]