Nameaae-let-7
AccessionMI0013505
SpeciesAedes aegypti
DescriptionAedes aegypti let-7 stem-loop
Comment
Locussupercont1.43+:1156326-1156396
Sequence
CACGUAGUGACUGAUUAAAUAUCUGCUAUGCAAUCUGCUAGCUUGUCGUG

Mature miRNAs [1]

Genome context [0]

Precursor family [308]