Nameaae-mir-100
AccessionMI0013497
SpeciesAedes aegypti
DescriptionAedes aegypti miR-100 stem-loop
CommentThis miRNA was identified independently in Aedes aegypti (Li S 2009) and in the closely related Aedes albopictus, for which there was no genome sequence (Skalsky RL 2010). The latter reads were therefore also mapped to the Aedes aegypti genome (Skalsky RL 2010).
Locussupercont1.43+:1142154-1142279
Sequence
GCGUAGUGGUUGUAGUUACCCAUUUGCAGGCUGCCGUUUCACAUGUUACAAGAACGGAUGUAUGGGAUUCUGCCGAUGUAUGGCUAAAGCAUCGAUCGAUUUGU

Mature miRNAs [1]

Genome context [0]

Precursor family [309]

Papers [8]